• We are available for your help 24/7
  • Email: info@isindexing.com, submission@isindexing.com


Novel Research in Microbiology Journal

Journal Papers (66) Details Call for Paper Manuscript submission Publication Ethics Contact Authors' Guide Line
1 Burden of fungal diseases in Egypt , Sherif M. Zaki
       Fungal diseases cause 1.5 million deaths and cause cutaneous infections to billions of people worldwide every year (Vos et al., 2012; GAFFI. 2015).        Egypt is the highest populated country in the Middle East and North Africa region. Due to the fact that many risk groups of patients exist in Egypt, Egyptians suffer from serious fungal diseases annually. Zaki and Denning, (2017) reported the estimation of the total burden of serious fungal diseases in Egypt and concluded that about 1,649,686 (2%) of Egyptians suffer from serious fungal diseases annually.
2 Antibacterial potency of garlic extract against certain skin pathogenic bacteria , Dadile M. Abdulrahman, Abdullahi M. Daskum, Kura M. Abdulrahim, Abubakar M. Dadile, Hajja Amma
       The antibacterial potency of garlic extract (Allium sativum) against gram positive and gram negative skin pathogenic bacteria including; Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, and Pseudomonas aeruginosa were studied using agar well diffusion and broth dilution assays. Agar well diffusion assay for aqueous garlic extract (AGE) was characterized with zones of inhibition ranging from 4.40 – 3.80cm, 4.13 - 3.57cm, 3.40 – 2.67cm for S. aureus, S. epidermidis and Strep. pyogenes, respectively, however, Ps. aeruginosa had lesser zone of inhibition ranging from 2.32 – 1.55cm. Studying the antibacterial potency of AGE against the selected isolates, revealed that it is affected by temperature of storage. Current results showed that storage of AGE at low temperature of - 20oC, does not affect its potency, however, its potency was slightly lost at high temperatures above 37oC. The broth dilution test was performed to investigate the Minimum inhibitory concentration (MIC) and Minimum bactericidal concentration (MBC) of the AGE against the bacterial isolates at 37oC. Investigating the activity of AGE loaded on Gel dressing revealed that it can have potency when applied on patients with Staphylococcal skin infections. Findings from this study encourage and support the use of AGE in treating bacterial skin infections especially in developing countries like Africa, as it is available, economic and have no side effects.
3 Identification of phytopathogens from a taxonomic view, an example of Cryphonectriaceae , Ning Jiang, Chengming Tian, Xinlei Fan
       Plant diseases cause lots of losses worldwide, and pathogens identification is essential during diseases studies. Traditional identification of phytopathogens mainly relied on host information and pathogen morphological characteristics, which limited the discovery of similar pathogens on the same hosts. Recently, the application of phylogenetics to plant pathology greatly promotes the discovery of larvaceous fungi. For example, novel genera in Cryphonectriaceae were described as phytopathogens continuously in the past two decades.
4 Insight from morphology and phylogeny in species delimitation of Diaporthe , Qin Yang, Xinlei Fan
       Members of Diaporthe are known as plant pathogens, endophytes or saprobes on a wide range of host plants. Diaporthe species are wellknown as the causal agents of many important plant diseases; including root and fruit rots, dieback, stem cankers, leaf spots, leaf and pod blights, and seed decay (Udayanga et al., 2011). Diaporthe helianthi is the causal agent of one of the most important diseases of sunflower (Helianthus annuus) worldwide, and is also listed in the Chinese quarantine directory (Thompson et al., 2011). For plant pathologists, studying of phytopathogenic Diaporthe spp. is therefore particularly important to work on wide range of plant diseases (e.g. grapes, sunflowers, soybean, and various diseases associated with ornamentals and forest trees). The taxonomy of Diaporthe spp. has recently been reviewed in several impactful studies (Udayanga et al., 2011; Gomes et al., 2013).
5 Production of silver nanoparticles (AgNPs) by certain bacterial strains and their characterization , Abo-State, M.A.M. and Partila, A.M.
       Development of biologically inspired experimental processes for the biosynthesis of nanoparticles (NPs) is an evolving important branch of nanotechnology. In the present work, we studied the potential of four bacterial species for extracellular production of nanosilver (AgNPs) from 3 mM concentration of silver nitrate (AgNO3) after incubation for 4h at 85°C. Biosynthesized AgNPs were characterized by using different methods such as; UV/vis spectroscopy, Transmission electron microscope (TEM), X-Ray Diffraction (XRD) and Fourier Transform Infra-red (FTIR) spectroscopy. Results of UV–vis spectroscopy showed maximum absorption at 401-432 nm, which represents the characteristic surface plasmon resonance of AgNPs. TEM demonstrated that the size range of these NPs ranged approximately from 7.8- 13.4 nm. Representing the XRD pattern obtained for the AgNPs, a number of Fcc structures of silver Bragg reflections corresponding to (100), (110), (111), (200) and (220) planes were observed. FTIR results recorded a downward shift of absorption bands between 400–4000 cm−1 indicating the formation of AgNPs. Finally we concluded that the extracellular biosynthesis of AgNPs by the four bacterial species; Ochrobactrum sp. (MAM-C9), Achromobacter xylosoxidans (MAM-29), Pseusomonas aeruginosa (MAM-42) and Bacillus cereus (MAM-I.11) were confirmed. This study recorded that bacterial biosynthesis of AgNPs is useful to avoid adverse effects of chemical and physical methods that are non-suitable for medical applications.
6 Control of Fusarium wilt of tomato in the greenhouse using silver nanofungicides , Adel K. Madbouly
       Tomato (Solanum lycopersicum) is considered as one of the most economically important vegetable crops in the world. Its production is about 130 million tons, of which 88 million are specified for the fresh markets whereas, 42 million are processed (Anonymous, 2016). Fusarium oxysporum f. sp. lycopersici causes a highly destructive vascular wilt disease of tomato leading to significant crop losses in the field and in protected tomatoes, thus remains as one of the main limiting factors for production of this crop (McGovern, 2015).
7 Management of date palm root rot diseases by using some biological control agents under organic farming system , Ahmed, M.F.A
       In the current work an attempt was made to find out the most suitable bioagents that have the ability to protect Date palm cv. Zaghloul (Phoenix dactylfera L.) from some soilborne fungal diseases. Several soilborne fungi were isolated from root rots of date palm trees located in the farms of El-Beheira Governorate, Egypt, including; Fusarium solani, F. oxysporum, Rhizoctonia solani and Macrophomina phaseolina, and their pathogenicity were confirmed on date palm seedlings in the greenhouse. These fungi cause economic losses in date palm yield and a wide range of other cultivated plants. Many different antagonistic isolates (bioagents) i.e. Trichoderma album, T. harzianum, T. viride and T. hamatum were isolated from the rhizosphere soil of healthy date palm trees. For comparison of results, bio-commercial preparations mainly “Bio-zeid (T. album 10×106 cfu/ ml)” and “Plant guard (T. harzianum 30×106 cfu/ ml)” were also used to detect their antagonistic potential against the mycopathogens of date palm. In vitro antifungal efficacy of the bioagents was evaluated against all the pathogens, where T. harzianum was the most effective as it caused 87.10, 81.55, 77.60 and 68.55% reduction in the radial growth of F. solani, F. oxysporum, R. solani and M. phaseolina, respectively. In vivo assays under field conditions, all tested biotic treatments significantly reduced severity of root rot diseases caused by the concerned pathogens. Moreover, they increased the percentages of survived date palm plants in infested soils during both successive growing seasons of 2016 and 2017, where T. harzianum was the most effective bioagent as it showed an increase in date palm survival of about 82.35 and 86.67% at both seasons, respectively. In addition, all bioagents enhanced the growth parameters of date palm, i.e. plant height (cm), number of leaves/ plant and number of leaflets/ leaf, compared with the control treatment. Thus, these effective bioagents could be used as biofungicides to control the root rot diseases of date palm in the field; accordingly, we could displace the use of non-ecofriendly and health hazards synthetic fungicides.
8 Efficacy of Pseudomonads as biocontrol agents of phytopathogens , Adel K. Madbouly       
       Microbial plant pathogens infecting different crops cause great economic losses worldwide. Thus plant diseases need to be controlled to maintain the quality and abundance of these crops. Different approaches have been used to control plant diseases, mainly chemical fertilizers and pesticides. However, environmental pollution and pathogens induced resistance due to excessive use of these agrochemicals; may exclude their successful application. Consequently, researchers have focused on developing alternatives to control plant diseases; among these alternatives is biological control. The term biological control or biocontrol applies to the use of living antagonists to suppress or kill deleterious plant pathogens. The saprophytic microbe which antagonises the pathogen is called the biological control agent (BCA) or bioagent.
9 Antibiogram of bacterial species causing skin wound infections , Mahesh Raj Pant, Dipti Shrestha, Shovana Thapa
       Wounds occur when the integrity of any tissues is compromised. Infection causes significant increase in costs, morbidity, and potential mortality. This study was conducted during the period from July, 2015 to January, 2016 with the aims of identifying the etiological agents causing skin wound infections, and their antibiotic susceptibility profile among patients visiting International Friendship Children’s Hospital (IFCH), Maharajgunj, Kathmandu, Nepal. Specimens were processed by conventional culture technique and antibiogram of isolates were done by modified Kirby-Bauer disc-diffusion method. Out of 219 skin pus samples, 132 (60.3%) were reported to be bacterial culture positive. Eight different bacterial species were identified as; S. aureus 75 (56.8%), Coagulase negative S. aureus (CONS) 20 (15.2%), Escherichia coli 13 (9.8%), Citrobacter spp. 7 (5.3%), Pseudomonas aeruginosa 5 (3.7%), Klebsiella spp. 5 (3.7%), Proteus spp. 5 (3.7%) and Enterobacter spp. 2 (1.5%), all were isolated from culture positive specimens. Antibiotic susceptibility test (AST) of all Gram-negative isolates showed that Colistin and Imepenum were the most effective antibacterial drugs. Out of total 75 S. aureus isolates, all were reported to be susceptible to Vancomycin, whereas, 23 (30.7%) were resistant to methicillin. This study reported that S. aureus strains were the predominant isolates. Prevalence of multi-drug resistant strains of S. aureus is increasing. Current results demonstrated that antibiotic resistance in Gram-positive and Gram-negative bacteria is increasing in alarming trends that lead to failure of treatment.
10 Nanoparticles as novel plant growth promoters , Adel K. Madbouly
        Crop plants are prone to infection by several pathogens which cause diseases that affect the production and economy of these crops. Farmers tend to use traditional control methods such as; chemical pesticides and bioagents which are non-ecofriendly and not easily produced/ applied, respectively. Nanoparticles (NPs) have sizes less than 100 nm and are considered for several applications including; agriculture, food technology, pharmaceuticals in addition to protection of environment (Chakravarty et al., 2015). Availability, low-cost and nonphytotoxicity of NPs are the main prerequisites for their application in the field of agriculture.
11 Detection of blaNDM-1 gene among the carbapenem resistant Escherichia coli and Klebsiella pneumoniae isolates from a children’s hospital in Nepal , Binod, G.C.; Nim Raj Sapkota; Binod Rayamajhee; Jayram Lamichhane; Pramod Poudel; Sunil Lekhak; Shovana Thapa; Santosh Khanal
       This study was undertaken to detect the presence of blaNDM-1 gene among the carbapenem resistant Escherichia coli and Klebsiella pneumoniae isolates, confirmed through using Modified Hodge Test (MHT). During the six months of this study (November, 2016 – April, 2017), a total of 1503 clinical samples including urine, blood, wound swabs and Cerebrospinal fluid (CSF) were collected and processed at Microbiology Laboratory, International Friendship Children’s Hospital, Kathmandu, Nepal. Among the E. coli and K. pneumoniae isolates, 14.1%, 17.1% were resistant to meropenem, whereas 11.28%, 17.1% were resistant to imipenem, respectively. From the pool of 94 E. coli and 35 K. pneumoniae isolates, 34 E. coli and 18 K. pneumoniae were screened as possible carbapenemase producers. For screening of carbapenemase enzyme production among these isolates, resistances to third generation cephalosporins and carbapenems were taken into consideration. Two isolates of E. coli and 3 isolates of K. pneumoniae were confirmed as carbapenemase producers by MHT. Furthermore, Polymerase chain reaction (PCR) was carried out among the MHT positive bacteria for detection of blaNDM-1 gene. Genetic analysis of MHT positive isolates showed that 1\2 E. coli and 2\3 K. pneumoniae isolates were New Delhi metallo-β-lactamase producers (NDM-1). Results of this study demonstrated the presence of blaNDM-1 gene among the carbapenemase producing E. coli and K. pneumoniae isolates, and were recorded to be 50% and 66.6%, respectively.
12 Microbiological analysis and total aflatoxins levels from shoot powder of Phyllanthus amarus (Schum. and Thonn) from Tororo, Uganda , Odda, J.; Aliero, A.A.; Waako, P. ; Obua, C.; Kabasa, J.D.
       Phyllanthus amarus (Schum. and Thonn) has been used traditionally for treating over 50 diseases globally including malaria in Tororo, Uganda. Although efficacy and acute toxicity studies of this plant have been determined, safety regarding microbiological analysis and total aflatoxins levels in this Ugandan shoot powder of P. amarus is still lacking. The microbiological analysis was determined according to the procedures recommended in WHO guidelines. Total aflatoxins were determined using Afla Test Kit, VICAM Series (South Africa). In terms of microbial analysis, the herbs were prepared based on indigenous knowledge according to the WHO criteria. Although this herbal shoot powder had microbial safety requirements with key microbial contaminants (i.e. mold fungi, Salmonella typhi, and Escherichia coli) within acceptable ranges, however, aflatoxins in all the investigated samples were beyond acceptable levels. Current results are useful in developing and establishing public health standards for the production and safe handling of herbal products of the Ugandan P. amarus.
13 Antagonistic potential of certain soilborne fungal bioagents against Monosporascus root rot and vine decline of watermelon and promotion of its growth , Abdelhak Rhouma, Ibtissem Ben Salem, Mahmoud M’Hamdi, Naima Boughalleb-M’Hamdi
       Monosporascus cannonballus responsible for cucurbits Monosporascus root rot and vine decline, is worldwide spread notably in Tunisia. The most appropriate strategies to suppress disease development are those able to reduce the ascospores population using eco-friendly approach treatments. Seven soilborne fungal isolates were tested in vitro (by dual confrontation technique) and in vivo in the greenhouse as potential bioagents against three virulent M. cannonballus isolates. In vivo experiments were divided into two assays, preventive and curative treatments. Trichoderma viride and T. harzianum exhibited high inhibitory activities against M. cannonballus mycelial growth with values more than 90%, followed by Aspergillus niger (87.89%) and Paecilomyces victoriae (80.44%). Furthermore, these two Trichoderma spp. when applied preventively and curatively in in vivo trials, reduced significantly disease incidence (8.33% and 16.67-20.83%), root disease index (0.79-0.8 and 1.25-1.17), and reduced also ascospores index (1.5-1.54 asc/g of peat) and (2.54-2.42 asc/g of peat), respectively, in comparison with control treatments. Moreover, T. viride and T. harzianum enhanced the growth development of watermelon plants treated preventively and curatively in the greenhouse. They significantly improved different horticultural measurements with mean values of plant height (76.75-79.83 cm, and 81.83-80.92 cm), root volume (2.39-2.22 cm3, and 1.84-1.88 cm3), above grounds fresh weight (16.07-16.57 g, and 12.84-14.93 g) and dry wt. (2.49-2.6 g, and 2.66-2.70 g), underground fresh wt. (0.725-0.654 g, and 0.717-0.690 g) and dry wt. (0.147-0.214 g, and 0.156-0.152 g). Based on current results, it appears that Trichoderma spp. could be employed in soil treatments to promote watermelon plant growth and development.
14 Recruitment of bacterial endophytes by host plants , Rawia F. Gamal
       Plants coupled with endophytic bacteria hold great potential for the remediation of polluted environments. The colonization patterns and activities of inoculated endophytes in the rhizosphere and endosphere of host plant are among the primary factors that may influence the phytoremediation process. However, these patterns and activities are in turn controlled by none other than the host plant itself.        The plant endosphere contains diverse groups of microbial communities. There is general consensus that these communities make significant contributions to plant health. Endophytes are microbial symbionts residing within the plant for the majority of their life cycle without any detrimental impact on the host plant. The use of these natural symbionts however, offers an opportunity to maximize crop productivity. Endophytes promote plant growth through; nitrogen fixation, phytohormone production, nutrient acquisition, and by conferring tolerance to abiotic and biotic stresses.        Colonization by these endophytes is crucial for providing their benefits to the host plants. Endophytic colonization refers to the entry; growth and multiplication of endophytic populations within the host plant. Although, plant microbiome research has gained considerable attention lately; however, the mechanism that allows plants to recruit endophytes is largely unknown.
15 Fungal contamination associated with some dried fruits in Iran , Amirreza Amirmijani; Mahdieh Sadeghian; Behanz Karimi
       In order to identify fungal species associated with some dried fruits including; Common fig, Date palm, and White Mulberry, 35 fruit samples were collected from common markets in the south of Kerman province, Jiroft, Iran, during 2016. After surface disinfestation with 0.5% NaOCl, small fragments of each dried fruit were plated onto Potato dextrose agar (PDA) medium. Recovered fungal isolates were purified by single spore method. Morphological characteristics of each isolate were recorded. Results of identification recorded that about seven fungal species including; Alternaria alternata, A. tenuissima, Arthrinium arundinis, Cladosporium cladosporioides, Clastospora gossypii var. polymorpha, Fusarium oxysporum and F. verticillioides were obtained. To the best of our knowledge, this is the first report of isolating and identifying the fungi associated with dried fruits in Iran.
16 Molecular diagnosis of begomovirus associated with leaf curl disease of Dahlia pinnata , Sayed S. Sohrab
       Diseases caused by begomoviruses represent serious threat to crop cultivation globally. A field survey was conducted in June, 2018 and severe leaf curl disease symptoms were observed on Dahlia pinnata at Ballia, U.P. India. The association of begomovirus was identified by polymerase chain reaction (PCR). The viral components were amplified by Rolling circle amplification (RCA); and digested with BamH1 and ECoRV which released the 2.7 kb fragment. The betasatellites was amplified by using betasatellites specific primers. The fragments were cloned, sequenced, analyzed and submitted to GenBank under the accession numbers (MK122994-full-length) and (MK122995-betasatellites). The full genome had total 2780 nucleotides, whereas betasatellites had 1347 nucleotides. The nucleotide sequence of full genome showed the highest identity (99.5%- 98.4%) with Tomato leaf curl Patna virus (ToLCPaV); infecting Casia tora, tomato, and Xanthium strumarium. The lowest sequence identity (37.9%) was observed with Chickpea chlorotic dwarf virus infecting X. strumarium in Pakistan. The betasatellites sequence showed the highest identity (99.2%) with Tomato leaf curl Patna betasatellites from C. tora. Currently, the association of begomovirus is known for Tomato, C. tora and X. strumarium in eastern U.P. and Bihar. Based on these findings, the begomovirus was tentatively known as a strain of ToLCPaV and designated as ToLPaV-Dahlia. This is a preliminary investigation about the natural occurrence of begomovirus causing leaf curl disease on D. pinnata in India.
17 Induction of defence enzymes activities in grape plant treated by seaweed algae against Plasmopara viticola and Uncinula necator causing downy and powdery mildews of grapes , T. Suthin Raj; S.Vignesh; P. Nishanthi; K. Hane graff; H. Ann Suji
       Plasmopara viticola and Uncinula necator are the causative agents of downy mildew and powdery mildew diseases, respectively, which become a major problem in grape crop (Vitis vinifera L.). The use of natural products such as seaweed provides a rich source of structurally diverse and biologically active secondary metabolites; and is the ultimate way of combating these diseases. In this context, six different seaweed algae such as; Sargassum wightii, Padina gymospora, Caulerpa peltata, Halimeda gracilis, Acanthophora spicifera and Gracilaria opuntia; were used to control the downy and powdery mildew diseases of grapes. Enzymatic studies were carried out during two growing seasons 1 and 2 on peroxidase; polyphenol oxidase, phenylalanine ammonia lyase and β-1,3- glucanase. During season 1; in grape plants treated with Sargassum wightii, the four enzymes raised the glucose concentration to 60.79µg, 3.87µg, 5.20µg and 225.5µg; respectively, and then these plants were treated with Bordeaux mixture at 1%. After seaweed application; enzymes raised the glucose level to 59.83µg, 3.57µg, 5.17µg, 221.7µg. During season 2; when plants were treated with Sargassum wightii, the enzymes raised the glucose concentration to 62.48µg, 5.93µg, 7.25µg and 226.2µg, and then these plants were treated with Bordeaux mixture at 1%. After application; the enzymes raised the glucose level to 61.92µg, 3.57µg, 7.21µg and 224.2µg, respectively. During both seasons; β-1,3-glucanase released more amounts of glucose in both normal plants and those treated with Bordeaux mixture. The present study was undertaken to evaluate whether various extracts of seaweeds algae such as; brown, red, and green seaweeds along with the defence enzymes studied, would increase the resistance of grapes to downy and powdery mildews.
18 Race and biovar determination of Ralstonia solanacearum in the north west of Pakistan , Muhammad Junaid; Musharaf Ahmad; Saifullah
       Multiple comprehensive surveys were conducted during 2012, in order to know the current status of bacterial wilt (BW) of tomato caused by Ralstonia solanacearum (R. solanacearum), in the commercial tomato growing districts of Khyber Pakhtunkhwa (KP), Pakistan. A total of 74 locations covering all the 26 districts of the 7 divisions of KP were visited for the presence of tomato plants showing BW symptoms. According to Polymerase chain reaction (PCR), the expected 281bp band was amplified from 25 candidates of R. solanacearum isolates, thus genetically confirming them to be R. solanacearum. These R. solanacearum isolates were subjected to race identification and biovar determination tests. Race differentiation was done using hypersensitive response (HR) test on tobacco plants; whereas 10% solutions of six different sugars including disaccharides (i.e. sucrose, lactose and maltose), and sugar alcohols (i.e. manitol, sorbitol and dulcitol) in Triphenyl tetrazolium chloride (TTC) medium, were used for biovars determination. Results indicated that all PCR-confirmed R. solanacearum isolates belonged to race-1 and biovar-3. However, two isolates i.e. (R. solanacearum11-DIK1 and R. solanacearum10- MDN2) were found to belong to race-3, biovar-2.
19 Prevalence of microorganisms associated with Pelvic inflammatory disease in reproductive aged women in Onitsha North, Anambra state, Nigeria , Eze, E.M.; Unegbu, V.N.; Ezebialu, C.U.; Nneji, I.R.
       The prevalence of pelvic inflammatory disease (PID) and its associated microbes among reproductive aged women in Onitsha north, Anambra state, Nigeria, were investigated. A total of 500 reproductive aged women between the ages of 10 - 50 years were examined; where 300 of them showed positive results. A total of 640 microorganisms were isolated. Nine (9) microbial genera were recovered consisting of seven bacterial genera; one yeast sp. and one protozoan isolate. Monomicrobial growth was recorded in 53 (7.17%), polymicrobial growth in 23 (7.7%) and bacterio-fungal growth in 10 cases (33%). Staphylococcus aureus accounted for 150 (50%) cases; followed by Escherichia coli 125 (41.7%), Streptococcus pyogenes 15 (5%), Klebsiella pneumonia 55 (18.3%), Proteus mirabilis 25 (8.3 %), Pseudomonas aeruginosa 64 (21.3%), Neisseria gonorrhoeae 62 (20.7%), Candida albicans 56 (18.7%), and Trichomonas vaginalis 88 (29.3%), respectively. Frequency of occurrence was predominant with the age groups of 21-30 and 31-40 years; conversely was least in ages of 10-20 and those age >51 years; respectively. There was significant statistical difference between microbial infection and the age-group (p<0.05). PID is a major public health problem, thus needs to be prevented and controlled.
20 In vitro antibacterial activity of ethanolic crude extracts of Capsicum annum against Staphylococcus aureus and Escherichia coli isolated from pus and stool samples at Ruhengeri Referral Hospital, Rwanda , Solange Gahongayire; Ibrahim Ntulume; Kagimbura Ervine; Bizimana Évariste; Adamu A. Aliero
       This work aimed at determining the antibacterial activity of ethanolic crude extracts of leaves and fruits of Capsicum annum against Staphylococcus aureus and Escherichia coli; isolated from pus and stools samples of patients in Ruhengeri Referral hospital, Rwanda. Fruits and leaves of C. annum samples were collected from Sina Gerard enterprise in Rulindo District in July, 2012. Plant samples were shade dried for 10 days, and then standard method was used for extraction using 96% ethanol as a solvent. Antibacterial activities of ethanolic crude extracts of fruits and leaves of C. annum were determined against E. coli and S. aureus using standard disc diffusion method. Minimum inhibitory concentrations (MIC) and Minimum bactericidal concentrations (MBC) were also determined. Results showed that crude extracts of leaves and fruits of C. annum had antibacterial efficacy against S. aureus and E. coli. The mean diameter of inhibition zones and standard deviation of fruits crude extract against S. aureus and E. coli ranged from 8.17± 0.15 to 11.0 ± 0.89 mm, and 14.0 ± 0.25 to 17.9 ± 0.35 mm; respectively, while those of leaves crude extract ranged from 9.7 ± 0.26 to 14.7± 0.25mm, and 8.7± 0.35 to 11.1 ± 0.38 mm; respectively, at increasing extract concentration from 50 to 200 mg/ ml. MIC of fruits ethanolic crude extract against E. coli and S. aureus was 25 and 12.5mg /ml; respectively, while MBC was found to be 50 and 25mg/ ml, respectively. However, MIC of leaves ethanolic crude extract against E. coli and S. aureus were 50 and 12.5mg/ ml respectively, while MBC was found to be 100 and 50 mg/ ml, respectively. We concluded from this study that, ethanolic crude extract of both fruits and leaves of C. annum collected from Rwanda had antibacterial potential against tested bacteria, thus could be used as sources of new drugs.
21 Pathogenicity and inoculum concentration effects of Clavibacter michiganensis subsp. michiganensis on severity of bacterial canker of tomato , Ayesha Bibi; Muhammad Junaid; Musharaf Ahmad
       A total of 100 tomato plant samples exhibiting typical symptoms of bacterial canker were collected from tomato-growing areas of north-western areas of Pakistan. On isolation of the causal agent of this disease, 47 out of 100 samples yielded typical colony morphology of Clavibacter michiganensis subsp. michiganensis, when grown on Nutrient agar (NA) medium. 34 isolates out of the 47 exhibited Clavibacter michiganensis subsp. michiganensis like cultural characteristics when grown on Yeast extract-Dextrose-CaCO3 (YDC) medium. However, 27 isolates only out of these 34 were confirmed to be Gram positive. Pathogenicity of the 27 Clavibacter michiganensis subsp. michiganensis isolates were confirmed using cotyledon, young seedlings and old seedlings assays. Results showed that all these isolates were able to cause bacterial canker disease symptoms on tomato plants. Cotyledon assay was negative for isolates from Mansehra (MNS2); whereas, MNG1 isolate didn't produce any symptoms for all three tests. Old seedlings test was negative for four isolates mainly; MKD2, MNG1, DIK1 and NWS2. To investigate the hypothesis that appearance of symptoms depends on inoculum concentration of pathogen; two aggressive isolates of Clavibacter michiganensis subsp. michiganensis i.e., MKD1 (from Malakand) and KLM1 (from Kalam) were inoculated into tomato plants at different concentrations (i.e. 1×102 - 108 cells/ ml). Results reported that earlier and more severe disease symptoms of bacterial canker were produced by the more aggressive isolate (MKD1); compared to the moderately aggressive isolate (KLM1), which produced milder and delayed disease symptoms on tomato plants.
22 Assessment of bacteriological quality of borehole water in Wamakko local government, Sokoto state, Nigeria , Bashir, I.; Adam, A.S.; Yahaya, H.S.; Makeri, D.; Ntulume, I.; Aliero, A.A.; Afolabi, R.O. 
       The increase in human populations together with their daily activities continues to have great influence on the quality of borehole water in Nigeria. In the current study, the major source of drinking water within Arkilla which is the one of the most growing community in Wamakko local government area of Sokoto state, were analyzed bacteriologically to ascertain their portability. A total of three water samples were collected from available boreholes within the major sites of Arkilla area namely; Arkilla layout, Arkilla federal low cost and Arkilla state low cost. They were analyzed for the total bacterial, coliform and faecal coliform counts using the standard plate count and most probable number (MPN) assays. Obtained results were compared with (WHO) standards for drinking water sources. The mean total bacterial count ranged from 5.4 ×104 to 3.7 ×106 cells/ ml, whereas, the total coliform counts of the water samples ranged from 12 -16 MPN/100 ml. The faecal coliform count ranged from 0-1 MPN/100 ml. General bacterial genera encountered were Escherichia coli, Klebsiella spp. and Enterobacter spp. The bacterial load recovered from the studied borehole water samples were above the WHO standard for bacterial loads, and coliform content. Therefore, current results suggest that some of the borehole waters in Wamakko local government area, Nigeria; were not safe for drinking.
23 Extracellular GroEL Promotes adherence of ΔrhlA mutant to inert surfaces in Pseudomonas aeruginosa , Sebnem Bukavaz
        Pseudomonas aeruginosa is particularly notorious producing robust biofilm. Bacterial biofilms are threedimensional systems, attached to inert or living surfaces that are surrounded by an extracellular matrix consisting of; extracellular DNA, proteins, exopolysaccharides, and secondary metabolites (Guilbaud et al., 2017).         There are evidences indicating that a biofilm matrix forms micro-environments in which cells are optimally organized to resist stress and use available nutrients. For example, eDNA acts as a biofilm scaffold by binding with other biomolecules, such as peptides, enzymes, proteins, and polysaccharides (Withchurch et al., 2002; Das et al., 2016). Zhang et al., (2015) pointed out that the polysaccharides provide mechanical stability, mediate bacterial adhesion to surfaces, and form a cohesive, threedimensional network that connects and immobilizes biofilm cells. However, the complex network leading to complete biofilm formation is not well understood. Alayande et al., (2018) reported that the quorum sensing system molecules and unknown secreted proteins involve P. aeruginosa biofilms.
24 Candidiasis and opportunistic mycosis in human , Habtamu Tedila; Addisu Assefa; Feto Haji
       Pathogenic fungi cause serious diseases in humans, plants and animals. These include mainly, Candida spp., Aspergillus spp., Cryptococcus spp., Fusarium spp., and Pneumocytis spp. Candida species cause infections in individuals with deficient immune systems, and Th1-type cell-mediated immunity (CMI) is required for clearance of this fungal infection. Candida albicans is an opportunistic pathogen of humans and has a parasexual cycle that appears to be stimulated by environmental stresses. Aspergilli represent the most common pathogenic species especially for Aspergillus flavus and A. fumigatus. A. flavus produces aflatoxins which act both as toxins and carcinogens, and can potentially contaminate foods. A. clavatus causes allergic disease of human; its symptoms include; fever, cough chest pain or breathlessness. Cryptococcus neoformans is one of the most effective human pathogens; it causes severe form of meningitis and meningo-encephalitis in patients with HIV infection and AIDS. C. gattii was endemic to tropical parts of Africa and Australia; cause disease in immunocompromised people. Fusarium spp. are important pathogenic mold fungi; second only to Aspergillus spp. Fusaria also produce toxins that could cause poisoning through consumption of toxin-contaminated foods. The aims of this review were to highlight the etiology, risk factors, pathogenesis, human defence and preventive measures of some of the most common fungal human pathogens, to avoid infections and their subsequent cause of fatal diseases.
25 Disease cycle and infection strategies of systemic plant pathogen Botrytis cinerea , Yahaya, S.M.; Mardiyya, A.Y.; Sakina, S.B.; Hayatu, L.W.
       Botrytis cinerea is a ubiquitous filamentous fungal pathogen of a wide range of plant species. This fungus is able to infect all aerial parts of its host plants; where infection may cause enormous damage both during plant growth and in the post-harvest stage (during cold storage or transport). B. cinerea is a major cause of economic losses in the production chain of cut flowers, bulb flowers and pot plants. Molecular-genetic studies performed over the past decade have provided a wealth of novel insights into the infection mechanisms utilized by this pathogen. Fungal genes important for successful infection by B. cinerea were identified. Such knowledge provided perspectives for designing novel, and rational plant protection strategies that could effectively counteract important pathogen virulence factors. In this study; the infection process will be divided into different stages; moreover, the role of various fungal enzymes and metabolites in the different stages will be discussed. The aim of the current study was to address perspectives for novel control strategies that may reduce and/or delay the damage incited by B. cinerea infection.
26 Green synthesis of silver nanoparticles using Portulacaria afra plant extract: characterization and evaluation of its antibacterial, anticancer activities , Taher A. Salaheldin; Ghadir A. El-Chaghaby; Mohamed A. El-Sherbiny
       Applications of nanotechnology in different areas of research have expanded over the last years. Silver nanoparticles (AgNPs) have beneficial effects as antimicrobials, antioxidants and/or anticancer. Yet, one of the major limitations of their use was employing toxic chemicals as reducing agents. Biosynthesis was advantageous over the physical and chemical synthesis. The obtained nanoparticles were characterized using the High-Resolution Transmission Electron Microscope. Disc diffusion method was used to evaluate the antibacterial activity of AgNPs against Bacillus subtilis, Escherichia coli, Neisseria gonorrhoeae, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus faecalis. Cytotoxic activity of biosynthesized AgNPs was tested against humane breast cancer cell line (MCF-7). Results of characterization showed that AgNPs were irregular spherical in shape, with average diameter of 27.41nm, and width of 4.36nm. The antibacterial assay showed that Portulacaria afra extract had no inhibitory potential against the tested bacteria. However, both AgNO3 and AgNPs exhibited recognized inhibitory potency against all tested bacteria. AgNPs exhibited wider inhibition zones than AgNO3. Cytotoxicity test revealed that green synthesized AgNPs had inhibitory activity against cancer cell line (MCF-7) which was concentration dependent, with IC50 of 75.40 µmole. The aims of the present work were to study the possible green synthesis of AgNPs using P. afra aqueous leaf extract as a reducing agent; to characterize them, to investigate the antibacterial potency and cytotoxic potential of these biosynthesized AgNPs
27 Detection of coagulase-positive Staphylococcus and its antibiotics resistance profile, recovered from cattle carcasses of the state of Paraná, Brazil , Gonçalves, A.P.P.; da Rosa, G.; Merlini, L.S.; Geronimo, E.; Borges, J.L.; Neto, A.P.; de Lima, J.S.; Almada, A.F.
       Staphylococcus sp. is a commensal bacterium in humans. Nonetheless, it is considered as an opportunistic microbe, being frequently associated with food poisoning outbreaks and antimicrobial resistance. The purpose of this work was to evaluate the presence of coagulase-positive Staphylococcus sp. in 100 cattle carcasses slaughtered in a slaughterhouse in the northwestern region of Paraná, Brazil, and to identify its in vitro resistance profile against different antimicrobials. Samples were collected through swabs from the slaughtered cattle carcasses, and then were forwarded to the Preventive Veterinary Medicine laboratory, at University of Parananese (UNIPAR). From the 100 samples, 18 (18%) recorded growth of microorganisms, and 16 samples of these were selected for the antimicrobial assay, according to the standard count for coagulase-positive Staphylococcus. Results of antibiogram showed that; 56.25% of the samples were resistant to Vancomycin, 50% to Penicillin, 31.25% to Tetracycline and Ampicillin, 18.75% to Erythromycin and Enrofloxacin, 12.5% to Oxacillin, 6.25% to Gentamicin and Clindamycin, whereas, only Cephalothin did not show resistance to any of the samples tested. Current study reported that antibiotic resistant strains (ARS) of coagulase-positive Staphylococcus sp. were present in the collected samples; and could have been originated from the food handlers, the utensils, the environment, or even from the animal itself. Accordingly, such results showed that it is important to stimulate the good hygiene and sanitary conditions of the food handlers, making them aware of their responsibility towards single health. Moreover, the indiscriminate use of antimicrobials may be responsible for the increase in the antibiotic resistant S. aureus.
28 Screening and interaction between pathogens and antagonistic seed-borne fungi, associated with some organic spices and vegetable crops in Tunisia , Ibtissem Ben Salem; Yosra Abdelkhalek; Houssem Nabli; Neji Tarchoun; Naima Boughalleb-M’Hamdi
       Seed-borne pathogenic and antagonistic fungi were isolated from the same organic vegetable and spice seeds (carrot, fennel, broad bean, faba bean, and lettuce), and the interaction between them were studied as a part of a biocontrol assay. In vitro dual culture assay between each pathogen and the antagonists on PDA medium was made, which led to the inhibition of the pathogens mycelial growth. According to results generated for fennel seed-borne fungi, direct confrontation of the five pathogens (Botrytis cinerea, Sclerotinia sclerotiorum, Cladosporium cladosporiodes, Cladosporium link and Bispora sp.), with Aspergillus niger and Penicillium digitatum showed an inhibition of radial growth above 50%. For lettuce; the highest inhibition was recorded by Trichoderma harzianum in confrontation with S. sclerotiorum, and P. digitatum in confrontation with Alternaria alternata. For carrot, three fungal pathogens were identified as: A. alternata, A. solani and Pythium sp., which were faced with three antagonists (P. chrysogenum, A. niger and T. harzianum), and showed radial inhibition about 50%. Concerning broad bean and baba bean; only A. alternta was isolated, and has been confronted with T. harzianum, P. digitatum, and P. italicum. During in vivo assays on fennel plant in the greenhouse; a disease severity index caused by various pathogens alone and in combination with antagonists compared to control plants, was recorded. According to results observed, fennel plants inoculated with B. cinerea and treated curatively with P. digitatum and preventively with A. niger; recorded a low disease severity index value of 0.22. This work was carried out to find effective seed-borne bioagents that could cause in vitro and in vivo inhibition of the growth of several fungal pathogens of vegetables; thus could be applied in the field for the biocontrol of fungal spice and vegetable crops diseases
29 Study of population dynamics of Clavibacter michiganensis subsp. michiganensis in exposed and buried crop debris , Ayesha Bibi; Muhammad Junaid; Musharaf Ahmad; Syed Fayaz Ali Shah; Iftikhar Hussain Khalil
       The aims of the current work were to determine the effect of burial depth (0, 6, 12 and 18 cm) on the degradation of diseased crop debris, and survival of the debris-borne bacterial inoculum. This study was carried out in two-locations namely; the Agricultural Research Institute, Tarnab, Peshawar, and the Haripur University, Haripur campus, Pakistan. Results revealed that the debris degraded at faster rate and the number of bacteria per gram of tissue declined more in buried samples than in exposed samples. Moreover, the decline in number of bacteria was more at greater depths than at shallow ones; suggesting that the use of turn-over ploughs after harvest would be helpful in reducing the crop debris-borne primary inoculum, and hence reducing the disease incidence. During a period of 270 days, the mean number of cells of Clavibacter michiganensis subsp. michiganensis (Cmm)\ gram of exposed stem tissue was reduced from 8.9×109 to 6.0×105 at ARI, Tarnab, and from 7.93×109 to 5.26×105 at Haripur. On the other hand, the mean number of cells\ gram of tissue at ARI, Tarnab buried at different soil depths of 6, 12, and 18 cm, decreased from 9.05×109 to 3.2×103 , 8.55×109 to 2.9×103 , and 5.8×109 to non-detectable; respectively, after 270 days of burial. Whereas at Haripur; the mean number of cells\ gram of tissue buried at the same depths decreased from 4.28×109 to 1.81×104 , 4.46×109 to 2.31×103 , and 3.82×109 to non-detectable, respectively, after the same period.
30 Biodegradation of hydrocarbons by halophilic bacteria isolated from the saltpans of Thoothukudi district, India , Laxmi, D.; Gayathri, C.
      Many halophilic microorganisms have evolved unique properties of a considerable biotechnological importance. In this study, two halophilic bacteria were isolated from the solar saltpans of the Thoothukudi district, located in Tamil Nadu, India, and were investigated for their hydrocarbon degrading abilities. These isolates were assigned names as GD30 and DM27; and then were subjected to morphological and molecular characterization, finally identified as Oceanobacillus oncorhynchi and Pseudomonas stutzeri, respectively. Among both isolates, DM27 specifically showed maximum growth and degradation activity of hydrocarbons (i.e. diesel and naphthalene). This hydrocarbon degrading ability was assayed by using 2, 6-dichlorophenol-indophenol (DCPIP) as an indicator. Our overall results demonstrated the potentiality of both halophilic bacterial isolates (Oceanobacillus oncorhynchi and Pseudomonas stutzeri), for biodegradation of hydrocarbons in contaminated saline soil.
31 Isolation, characterization, and detection of antibacterial activity of a bioactive compound produced by marine Bacillus sp. MH20 from Suez Bay, Egypt , Mahmoud Saber Kelany; Ehab Aly Beltagy; Maha Abd El-Fattah Khalil; Mohamed Ahmed El-Shenawy; Wagih Abd El-Fattah El-Shouny
       This study focused on isolating and identifying a new bacterial strain from marine water and sediments of Suez bay, Timsah Lake, Egypt; capable of producing a bioactive secondary metabolite. Of the 552 bacterial isolates recovered, only 40 of these isolates exhibited antagonistic activities against different bacterial pathogens. A promising bacterium isolated from Suez bay marine water was identified as Bacillus sp. MH20 using 16S rRNA sequencing, and deposited in GenBank with accession number KM374670. This isolate showed sequence similarity of 88% to B. sonorensis strain NBRC 101234. Well-cut diffusion assay was adopted to determine the in vitro antibacterial activity of the active compound produced by this bacterium; whereas, GC-MS analysis was used to identify the components of this bioactive substance. GC-MS analysis showed that the active principle might be Phthalic acid, octyl 2-pentyl ester with retention time of 23.13 min. Crude extract of Bacillus sp. MK20 at a concentration of 200 mg/l exhibited LC50 of 2.5 ppm against Artemia salina. The aims of the current work were; to isolate and identify one of the promising bacterial strain from marine water, capable of producing bioactive antibacterial compound and evaluating its bio-toxicity, for its potential use in the control of bacterial human, animal and fish diseases.
32 Genetic diversity of Fusarium solani f.sp. cucurbitae the causal agent of crown and root rot of watermelon in Tunisia using ISSR markers , Naïma Boughalleb-M’Hamdi; Najwa Benfradj; Ibtissem Ben Salem; Paloma Abad-Campos
       Fusarium solani f.sp. cucurbitae (F.s.c.) Snyder and Hansen is one of the most important fungi causing serious damages to the cucurbits production areas in Tunisia. The goal of this investigation was to study the genetic characterization of F. solani f.sp. cucurbitae Tunisian population. Ten isolates of F.s.c. (F.s.c.1 to F.s.c.10) collected from infected watermelon plants in numerous regions of Tunisia; were subjected to PCR identification using ITS1-ITS4 primers pair, and Inter-simple sequence repeat (ISSR) technique. Results obtained confirmed the presence of F. solani f.sp. cucurbitae race 1 in Tunisia. ISSR dendrogram of the ten F.s.c. isolates generated by bi- and trinucleotide primers; and conducted by the unweight pair grouping using mathematical averaging (UPGMA) method from Nei’s genetic distance, revealed the presence of similarities between the isolates that ranged from 31 to 84%. The isolates F.s.c.8 (collected from Gabes) and F.s.c.4 (collected from Sidi Bouzid), were genetically dissimilar presenting the lowest similarity coefficient. In contrast; isolates F.s.c.3 (collected from Sfax) and F.s.c.1 (collected from Beja) were similar. Cluster analysis based on UPGMA of the ISSR markers data assembled F.s.c. isolates into two major groups. These results are helpful to develop integrated management and future breeding programs for plant resistance.
33 In vitro inhibitory potential of two synthesized fatty amides derivatives against some microbial pathogens , Fatiha Malki; Abdelkader Touati
       In the present study, two amide derivatives with long chains; N-cyclohexyloctamide 1 and NPhenyldodecanamide (dodecanilide) 2 were synthesized. They were tested in vitro for a wide array of antimicrobial activities against; two Gram positive bacteria (Bacillus subtilis, Staphylococcus aureus), four Gram negative bacteria (Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella enteric), and three fungi (Aspergillus carbonarius, Mucor ramannianus, Candida albicans), to evaluate their potential use as antimicrobial agents. Zones of inhibition of these compounds were determined by disc diffusion assay. Results revealed high antimicrobial activities of the two amides. The new fatty N-cyclohexyloctamide 1 showed significant antimicrobial activity against S. aureus and A. carbonarius, and was more active against C. albicans than synthesized fatty anilide 2, as it caused higher zones of inhibition. On the other hand, the fatty anilide 2 demonstrated high antibacterial activity against P. aeruginosa, and was more active against S. enteric than substituted fatty amide 1. On the basis of these obtained results, it could be assumed that fatty amide derivatives may be used as components of disinfectants, and may be possible sources of new drugs effective against various infectious diseases.
34 Effect of Beta vulgaris root extracts in Rayeb milk on its microbiological, chemical and nutritional composition , Abeer, F. Ahmad; Afaf, O. Ali
       The purpose of this study was to examine the use of beetroot (Beta vulgaris L.) extracts as natural colorant and antibacterial additives in Rayeb milk. Citric acid: ascorbic acid (2:1) (BCA) and citric acid (0.2%) (BC) were used as extraction solvents of beetroot. Antibacterial activity; minimum inhibitory concentration (MIC), minerals content (calcium, iron, phosphorus, potassium, and selenium), and phytochemical screening were determined in BCA and BC extracts. Moreover, the antibacterial potential, microbiological analysis, and pH were estimated for Rayeb milk supplemented with beetroot extracts after storage for different periods; 0 time, 5, and 10 days. Sensory evaluation was also carried out after 0 and 10 days of storage of Rayeb milk samples. Results of disc diffusion assay showed that both beetroot extracts were more effective against Pseudomonas aeruginosa, and less effective against Escherichia coli. The lowest MIC was determined for both extracts. Rayeb milk supplemented with extracts showed antibacterial potential toward the tested bacteria. Addition of beetroot citric acid: ascorbic acid (2:1) extract to Rayeb milk; led to a decrease in its total bacterial count, and increase in number of Lactic acid bacteria (LAB). Colored RBCA extract had more acceptable flavor and color. Results of the current work suggested that beetroot extracts could be used as natural additives to Rayeb milk with several advantages including; their antibacterial potency, positive effects on the phytochemical and chemical composition of Rayeb milk.
35 Prediction of antigenic epitopes for coat protein of Potato virus Y, Egypt , Seham Abdel-Shafi; Ghaly Mohamed Farouk; Mohamed Taha; Khalid El-Dougdoug
       Isolated Potato virus Y Egypt (PVY- EG) obtained from naturally infected potato plants in El-Sharkia, Egypt, was identified by biological, molecular and serological assays. The aims of this study were to predict the antigenic determinants (epitopes) of the isolated PVY using immunoinformatics; to prepare antibodies then apply them for PVY screening in potato plants in the field, as well as comparison with antibodies against coat protein. The amino acid sequence of PVY isolate was expected by DNAStar protean system; in which four parameters for epitope prediction including antigenicity, surface probability, hydrophobicity and secondary structure were used. These models were applied to PVY as a case study to predict immunogenic peptides for antibodies production. The most hydrophilic regions of PVY-coat protein (PVY- CP) were; 36-40, 46-47, 67-74, 96-98, 130-133, 164-166 and 198-200, which showed high hydrophobicity of this protein. This indicated that this protein was one of the best candidates to be immunogenic, and capable of producing antibodies that cross react with PVY. The peptide was chemically synthesized and injected into a rabbit. Obtained antibodies were evaluated using Double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), and Immune Dot-Blot assay. These antibodies positively reacted against PVY infected potato tissues.
36 Molecular identification and pathogenicity of Ralstonia solanacearum isolates collected from north west of Pakistan , Muhammad Junaid; Ayesha Bibi; Musharaf Ahmad; Muhammad Ali; Yousaf Noor
       In the tomato commercial growing districts of Khyber Pakhtunkhwa (KP); a province in the north west of Pakistan, multiple comprehensive surveys were conducted during 2012. The main objectives of the current study were to identify the Ralstonia solanacearum (R. solanacearum) isolate through its colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-triphenyltetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band
37 Detection of Cucumber mosaic cucumovirus in infected cowpea plants (Vigna unguiculata L.) from northern Egypt , Mahmoud Hamdy Abd El-Aziz; Hosny Aly Younes
       Cucumber mosaic cucumovirus (CMV) was isolated from naturally infected Cowpea plants (Vigna unguiculata L.) showing different symptoms of mosaic; mottle, dwarfing, and vein clearing, grown at certain locations of Alexandria governorate, Egypt, during the growing seasons from 2011- 2012. CMV isolate was transmitted by Aphid nerii, A. gossypii, and Myzus persicae in non-persistent manner. The virus was partially purified using polyethylene glycol (PEG) 6000, and differential centrifugation. The ratio of A 260/280 was 1.622 and A 280/260 was 0.617. Whereas, the ratio of A max/ min was 1.915. Concentration of the virus in the preparation was estimated using an extinction coefficient of E 2600.1% = 5. Yield of purified virus was about 6.88 mg/ 100g fresh weight of leaves of Nicotiana glauca. Antiserum titer was determined by Indirect enzyme linked immunosorbent assay (ELISA). Positive ELISA values were obtained up to dilutions of 1: 25600. The virus was detected by indirect ELISA in infected sap at 8, 16 and 24 days after inoculation; and by Tissue blot immunoassay (TBIA) on nitrocellulose membrane after the same period. The unused face of the processed nitrocellulose membrane already printed with plant tissues was tested. Results revealed that both faces of nitrocellulose membrane and Canson paper could be used as solid carriers in TBIA, for detection of CMV in infected leaves. According to Reverse transcription polymerase chain reaction (RT-PCR); the size of amplification of the obtained product was approximately 870 bp for CMV isolate; and was assigned accession number of LN606587. The Phylogenetic tree was generated using partial sequence of CMV isolate, with those of other CMV isolates obtained from GenBank. The aims of the current work were; to produce specific polyclonal antiserum against the purified CMV isolated from cowpea plants, and to register this isolate in GenBank.
38 Recombinant human insulin as a solid tumor potential imaging agent: Radio-synthesis and biological evaluation , Gamal Abdelaziz; Motaleb, M.A.; Farouk, N.; Adli A. Selima
       The aim of this study was to synthesis an imaging agent for tumor targeting. New recombinant insulin analogue was successfully produced from E. coli by recombinant DNA technique, and was well labeled with Technetium-99m with a high radiochemical yield of 93.3 ± 2.1 %. Moreover, it showed good in-vitro stability in both saline and human serum. Preclinical evaluation of Technetium-99m [99mTc] Tc-insulin in solid tumor-bearing mice showed high accumulation in tumor tissues. The T/NT (target to non-target ratio) was of 5.4, after 60 min. of post injection (p.i). The direct intra-tumoral (I.T) injection of [99mTc] Tc-insulin showed good retention in tumor tissues with a ratio more than 50 % after 15 min. As a result of the promising bio-distribution studies; the newly recombinant insulin showed good uptake in tumor site, which assured high concentration of insulin receptor on tumor cell surface, accompanied with high cell density of tumor cells as well. This work affords a potential radiocarrier that could be used as a good tumor marker and imaging probe via SPECT (Single Photon Emission Computed Tomography) technique, after further preclinical studies.
39 Purification and cytotoxic assays of four antimicrobial metabolites extracted from Actinomycetes of the soils of Menengai Crater, Kenya , Waithaka, P.N.; Mwaura, F.B.; Wagacha, J.M.; Gathuru, E.M.; Githaiga, B.M.
       The search for antibiotic metabolites is increasing due to drug resistance been witnessed today. This study was conceived to isolate, identify and compare the antimicrobial metabolites yield of four actinomycetes isolated from Menengai crater soil, Kenya. The actinomycetes were isolated using starch casein, Luria Bertani (M1) and starch nitrate agar. The antimicrobial metabolites were extracted using standard techniques followed by purification, test for antagonism against selected pathogenic microbes, and cytotoxicity assay using Brine shrimp lethality test. Totally, 138 actinomycetes isolates were obtained from all the soil samples. Four isolates showed the highest potent potential against selected bacterial and fungal pathogens. The selected actinomycetes were coded; PAN 30, PAN 37, PAN 41, and PAN 154, and preserved at 4°C for further analysis. The difference in yield of the antimicrobial metabolites between liquid and solid-state fermentation was statistically significant (P= 0.005). Zones of inhibition did not vary significantly (F = 6.6046, P = 0.001338). The minimum inhibitory concentration (MIC), minimum bactericidal concentration (MBC), and minimum fungicidal concentration (MFC) of the antimicrobial metabolites extracted from PAN 30, PAN 37, PAN 41 and PAN 154 isolates were equal. The Half Lethal Concentration (LC50) in (µg/ ml) for the antimicrobial metabolites extracted from the 4 isolates were; PAN 30 (1.8168 ± 0.47), PAN 37 (3.4269 ± 0.56), PAN 41 (3.4269 ± 0.45), and PAN 154 (4.9397 ± 0.41). The four actinomycetes produced bioactive metabolites. Solid-state fermentation was superior to liquid-state fermentation in recovering the antimicrobial metabolites from the actinomycetes isolates. Molecular identification of the selected isolates needs to be carried out in a future study. Moreover, there is a need to determine the structure of the antimicrobials using nuclear magnetic resonance.
40 Chemical constituents, antioxidant and antimicrobial activities of Pterygota alata (Roxb.) leaves extracts grown in Egypt , Maha E. Omran; Azza A. Shafei; Sally E. Abdel-Rahman
       Overproduction of reactive species and microbial resistance to the existent antibiotics are still great health challenges. The current study aimed to evaluate the antioxidant and antimicrobial activities of Pterygota alata leaves extracts, in addition to isolation and identification of their chemical constituents. In vitro antioxidant activity was explored using 2,2'-diphenyl-1-picrylhydrazyl radical scavenging assay (DPPH), whereas the in vitro antimicrobial activity was evaluated using the disc agar plate method. Chemical constituents of the leaves extracts were isolated through column chromatography, and then identified using 1H, 13C-NMR and IR spectroscopic tools. In the DPPH assay; the half maximal inhibitory concentration (IC50) value of the total extract was 72.4 ± 1.4 µg/ ml, relative to 11.2 ± 0.6 µg/ ml of the standard ascorbic acid. On the other hand; the antimicrobial results revealed that the ethyl acetate extract showed the strongest inhibitory potential against most of the tested microbes with inhibition zones of 16.8- 22.8 mm, followed by petroleum ether with inhibition zones between 13.4- 19.6 mm, and n-BuOH with inhibition zones ranging from 14.9-19.3 mm. These results were compared with the standard antibiotics such as; Amphatricin β, Ampicillin, and Gentamycin. Furthermore; chromatographic isolation of the different solvents extracts resulted in the isolation of five phytoconstituents, their chemical structures were assigned as; β-sitosterol (1), apigenin-7-β-D-glycoside (2), gallic acid (3), luteolin-7-β-D-glucoside (4), and 4'- methoxy myricetin-3-β-D-glucoside (5). Current findings suggested that leaf extracts of P. alata could be used for the development of natural drugs; to treat microbial infections and reactive oxygen species (ROS) associated disorders.
41 Prevalence of keratinophiic fungi and other dermatophytes from soils of Nnewi in Anambra state, Nigeria , Eze, E.M.; Ezebialu, C.U.; Unegbu, V.N.; Nneji, I.R.
       This study was carried out to isolate and identify the keratinophilic fungi and other dermatophytes present in soils of Otolo Nnewi, Nnewi north local government area, Anambra state, Nigeria. Eighty soil samples were collected from four habitats (playgrounds, abattoir, public parks, and poultry farms) of Otolo Nnewi; and were screened for the presence of keratinophilic fungi and dermatophytes, using hair baiting techniques for isolation of these fungi. Of which, 69 soil samples (86%) were positive for fungal growth. Fungal growth appearing on the baits after 2-4 weeks of incubation at 37°C were macroscopically and microscopically examined, and were also cultured on Sabroaud dextrose agar (SDA). These fungal isolates were identified on the basis of colony and microscopic features. A total of 150 isolates of keratinophiic fungi were detected. The isolated fungi were classified into 19 species belonging to 11 genera mainly; Chrysosporium indicum, C. tropicum, Aspergillus flavus, Microsporum gypseum and Trichophyton terrestre were isolated frequently. C. indicum (13%) was the most predominant isolated species; C. tropicum (12%) was the second, followed by A. flavus (11%). In the current study; M. gypseum (9.3%) was the most common isolated dermatophyte, followed by T. terrestre (6%) and T. rubrum (6%). M. canis was isolated only from soils of abattoir and public parks. Moreover, C. zonatum, T. mentagrophytes, Alternaria alternata and Fusarium oxysporum were also isolated. There was significant statistical difference (p<0.05) between the keratinophilic fungi and dermatophytes isolated from soil samples of these different habitats. Results obtained from this study indicated the wide occurrence of keratinophilic fungi in the studied area, which were potential agents of human and animals fungal diseases.
42 Antitumor efficacy of biosynthesized manganese nanoparticles , Eman Abuheiba; Sawsan M. El-Sonbaty; Nahed Abdel-Samed; Eman Kandil
       This study aimed to evaluate the in vitro and in vivo antitumor potential of manganese nanoparticles, in management of hepatocellular carcinoma (HCC) induced in rats. Manganese nanoparticles were biosynthesized using Lactobacillus helveticus cells. In vitro study of manganese nanoparticles on HepG-2 (human cell line of a well-differentiated HCC) revealed an IC50 of 21.5 mM. The in vivo efficacy of manganese nanoparticles was evaluated by measuring the antioxidant activities against oxidative stress caused by diethylnitrosamine (DEN) in rates liver tissues. This treatment significantly improved the alanine aminotransferase (ALT) activity and total protein compared to DEN group. Results showed that manganese nanoparticles were effective in treatment of HCC induced by diethylnitrosamine (DEN) in rats. So manganese nanoparticles can serve as a good therapeutic agent for the treatment of hepatocellular carcinoma, and deserve further studies in the future.
43 Effects of postharvest handling practices on quality of groundnuts and aflatoxin contamination , Dambolachepa, H.B.; Muthomi, J.W.; Mutitu, E.W.; Njoroge, S.M.
       The increased cases of aflatoxin contamination are exacerbated by poor post-harvest management practices, coupled with adverse climatic conditions at harvest and post-harvest stages. This study therefore was carried out to improve safety and quality of groundnuts from aflatoxin contamination, through use of proper postharvest handling practices. Specifically the study determined the effects of harvesting dates and drying methods on aflatoxin contamination. Field experiments were carried out both at Chitedze and Chitala Agricultural Research Stations in Malawi during 2017/2018 growing season. A randomized complete block design in a split plot arrangement with three harvesting dates as the main plot and four drying methods as the sub-plots replicated three times was used. Groundnut was assessed for kernel infection by Aspergillus flavus, and level of aflatoxin contamination. Significantly low levels of about 0.5µg/ Kg of A. flavus infection and aflatoxin contamination were observed at 90 days after sowing (DAS). Higher aflatoxin contamination of up to 5µg/ Kg was observed at 80 DAS, and 10 days late after physiological maturity (100 DAS). This study also identified Mandela cock, aframe drying rack as effective drying method that can reduce aflatoxin contamination in groundnuts by 75 %. Moreover, Mandela cock drying method was shown as the most effective compared to A-frame and drying rack drying method. Current study therefore recommends for adoption of timely harvesting at physiological maturity, and drying using either Mandela cock or A-frame and drying rack. Further studies need to be carried on biological control of aflatoxin contamination.
44 Escherichia coli in broiler chickens in Egypt, its virulence traits and vaccination as an intervention strategy , Ahmed Ali; Ahmed I. Abd El-Mawgoud; Al-Hussien M. Dahshan; Azza A. EL-Sawah; Soad A. Nasef
       Avian pathogenic Escherichia coli (APEC) is one of the extra intestinal pathogenic E. coli (ExPEC). Previous studies showed that O1, O2 and O78 serotypes are mostly associated with Colibacillosis outbreaks, but recently there are emergent new pathogenic serotypes that have spread worldwide. Wide antigenic diversity exists among APEC strains in Egypt; however, the involvement of a particular O serotype in the infection process appears to vary with the geographical region. Different virulence genes have been identified in APEC. Recently; the presence of these virulence genes is being employed as an indication of pathogenicity, rather than the tedious E. coli serotyping methods. In Egypt; several virulence genes were studied, and were found to be different based on the geographical area. However; all studies were limited to a small number of screened virulence genes, in addition to the inconsistency of these screened genes. To control APEC, antibiotics have been used for decades; however the emergence of multi-drug resistant E. coli, and the difficulty of discovering new antimicrobial therapies made vaccine the best choice to control E. coli infections in poultry farms. In this review, the various aspects of APEC infection in poultry with special focus on the epidemiology of APEC in Egypt in relation to virulence traits were discussed. In addition, the most recent vaccination trials against the APEC diseases in poultry were discussed. We concluded that the virulence gene patterns of APEC can be considered as molecular markers of pathogenicity. Although of their current limitations, some vaccine trials showed promising results as good alternative to control colibacillosis in poultry.
45 The effect of Lactobacillus acidophilus as a probiotic against Pseudomonas aeruginosa growth and biofilm formation , Shaimaa A. Elbadri; Marwa S. Fathi; Amira E. Abdel Hamid; Hanaa M. Abd Allah
       The emergence of antibiotic-resistant biofilm producing microorganisms such as Pseudomonas aeruginosa has pushed efforts to find safe alternatives to antibiotics; such as probiotics. Lactobacilli are one of these promising probiotics, with reported antibacterial and anti-biofilm activity against many different pathogenic microorganisms. This study aimed to study the potential antibacterial and anti-biofilm effect of Lactobacillus acidophilus ATCC 4356, against the growth and biofilm formation of pathogenic P. aeruginosa. Cell free supernatant of L. acidophilus was tested to inhibit the growth; biofilm formation, and on preformed biofilms by 35 different clinical strains of P. aeruginosa, using agar well diffusion and microtitre plate assays. L. acidophilus ATCC 4356 recorded powerful growth inhibition against 88.6% of the P. aeruginosa strains. Moreover; it significantly inhibited biofilm formation of the strains by 68.52%, and removed already preformed biofilms with 43.8 % activity. Finally; L. acidophilus showed a potent inhibitory potential against the growth and biofilm formation by P. aeruginosa strains, thus could be used as a powerful probiotic for the bio-control of infections caused by antibiotic resistant and biofilm producing P. aeruginosa.
46 The relationship and relativity between three isolates of Potato virus Y Potyvirus infecting potato (Solanum tuberosum L.) at Alexandria and El-Beheira governorates, northern Egypt , Mahmoud H. Abd El-Aziz; S.I. Behiry; H.A. Younes; Karrar A. Hamza
       Potato virus Y (PVY) is a highly pathogenic virus, causing enormous economic losses in potato (S. tuberosum) crop. Three isolates of PVY were obtained from naturally infected potato plants showing mosaic; yellowing and vein necrosis symptoms, during 2017-2018 growing seasons at certain locations of El-Beheira and Alexandria governorates, Egypt. PVY could be easily transmitted mechanically by aphids. Detection of the PVY3 in different organs of infected Nicotiana glutinosa plants by Indirect-ELISA; Dot blot immunoassay (DBIA) and Tissue blot immunoassay (TBIA), indicated the possibility of using these methods for viral detection. Egyptian PVY (MK376452) isolate was of close homology to PVY isolated from South Africa. The other Egyptian isolates were found to be close to a French PVY (KJ741115) isolate. There were variations on comparing nucleotide and amino acid sequences; however, nucleotide sequencing could be more reliable. Application of sequence inspection allowed us to identify the PVY isolates by phylogenetic analysis. Phylogenetic analysis of the genomic coat protein (CP) from 24 PVY isolates registered in GenBank indicated the presence of relationships between each other's. This reflected the high degree of genetic variability among our local Egyptian isolates. The aims of the current work were to; isolate and detect PVY from naturally infected potato plants in northern Egypt, characterize the PVY isolates using different assays, detect PVY in different organs of infected potato plants, study the CP gene of the PVY isolates using Reverse transcription-Polymerase Chain Reaction (RT-PCR), and register these isolates in GenBank.
47 Molecular, serological and biological characterizations of Potato Leaf Roll Virus in infected potato plants in Egypt, and its effects on plant cell organelles , Dalia G. Aseel; Mahmoud H. Abd El-Aziz; Sanaa A. Riad; Azaa Makhlouf; Gaber I. Fegla; Elsayed E. Hafez
       Potato Leaf Roll Virus (PLRV) is one of the most serious viruses infecting potato plant (Solanum tuberosum L.) in Egypt. Indirect Enzyme Linked Immunosorbent Assay (Indirect- ELISA) results revealed that 70 % of the collected samples were infected with PLRV. A multiplex Polymerase Chain Reaction (PCR) was carried out using three different sets of primers, specific for both PLRV and Potato virus Y (PVY) isolates. For confirmation; the movement coat protein (MP) gene was isolated from the infected plant tissues, and a band with molecular size 336 bp was obtained using Reverse transcription-Polymerase chain reaction (RT-PCR). The DNA sequence of the Egyptian PLRV-Banha -MP gene was deposited in GenBank under an accession number of KR002119. Moreover, sequence analysis revealed that the Egyptian PLRV isolate was closely related to a New Zealand isolate of PLRV (GU002341), with identity of 100%. Transmission electron microscope (TEM) examination of PLRV showed isometric particles, with approximate size of 24-30 nm. The cytopathological examination of the potato plant infected with PLRV revealed many cellular effects such as; partially degraded and deformed chloroplast, starch with an increased size and color change, in addition to nucleus and cytoplasmic bridge. It could be concluded that PLRV is present in Egypt, infecting most of the potato cultivars. Moreover, four different strains of PLRV were detected based on the Single strand conformation polymorphism (SSCP) of the MP gene. The aims of the current study were to identify the PLRV infection of potato plant in Egypt using; molecular, serological and biological methods, in addition to studying the effect of this virus on potato cell organelles. This is the first record of the presence of four different strains of PLRV infecting potato in Egypt, using SSCP assay.
48 Microalgae as sources of biofuel production through waste water treatment   , Muhammad Usman Akhtar; Abid Ali Khan; Wajeeha Jahangir Khan; Tiyyaba Furqan  
The shortage of fuel in the near future and the change in climate due to greenhouse gases are serious challenges of a global concern, thus it is imperious to explore new sustainable ways to overwhelm these challenges. The need of a new sustainable energy sources has increased the importance of the third generation biofuel produced from non-food stocks such as algae, which possibly represent a great opportunity in the long term. The major challenge of the algae based bio-fuel production is their extraordinary cultivation costs, which make their commercialization economically infeasible. Algal spp. especially Chlorella spp. are capable of thriving in waste water and can accumulate high lipid contents. The aim of the current review was to highlight the possible integration of waste water treatment and algae based bio-fuel production, as a sustainable option for cost effective bio-fuel production along with lower environmental impact.  
49 Effect of organic amendments on the decontamination potential of heavy metals by Staphylococcus aureus and Bacillus cereus in soil contaminated with spent engine oil   , Adeniyi O. Adeleye; Mohammed B. Yerima; Michael E. Nkereuwem; Victor O. Onokebhagbe; Peter G. Shiaka; Florence K. Amoo; Ibrahim K. Adam  
This study was conducted to assess the decontamination of heavy metals of an environmental concern in spent engine oil (SEO) contaminated soil, through the adoption of Staphylococcus aureus and Bacillus cereus co-cultures, isolated from Dutse mechanic village, Nigeria. About 1.5 kg of autoclaved soil was contaminated with SEO at three levels. The sterilized soil was then amended with compost, powdered cocoa pod husk (CPH), and powdered cow dung (CD). Subsequently, bio-augmentation with bacterial co-cultures (150 ml) was done. Heavy metal concentrations; Arsenic (As), Cadmium (Cd), Chromium (Cr), Nickel (Ni) and Lead (Pb) were estimated at the commencement, at the fifth and tenth week of the study. The factorial experiment was laid out in a completely randomized design (CRD). Results indicate that bio-stimulation adopted through the amendments did not have significant effects on the bacterial decontamination of soil especially at the 5th week (P> 0.05). CD only influenced the decontamination of Cd at 5% contamination level (0.0008 mg\ kg), compared with compost that recorded the least effect (0.00360 mg\ kg) at the 5th week. Meanwhile, CPH had the highest decontamination effect on Cr (0.004 and 0.000 mg\ kg) at 10% and 15% contamination levels; respectively, at the 5th week. However at the 10th week, complete removal of As was influenced by compost, CPH, and CD using 5%, 10% and 15% SEO contamination levels, respectively (P< 0.05). The decontamination efficacies of S. aureus and B. cereus recorded in this study is an indication of their potentialities for application in bioremediation of heavy metals.                                              
50 Antimicrobial and antioxidant activities of Tea plant , Zakaria Ahmed
Many complementary and alternative medicines have enjoyed increased popularity in recent decades. Efforts to validate their use have seen their putative therapeutic properties, which come under increasing scrutiny in vitro and in some cases in vivo. One of such products is tea and its tree oil (TTO); which is a secondary metabolite derived from tea plant (Melaleuca alternifolia). Both black and green tea has several polyphenolic compounds with possible antibacterial effects. It is employed largely due to its antimicrobial properties, and is incorporated as the active ingredient in many topical formulations used to treat cutaneous infections, in addition to being marketed as a remedy for various ailments. The essential oil of M. alternifolia exhibits broad-spectrum antimicrobial potential. The TTO may help to treat severe yeast infections. Results also suggested that TTO exerts a greater bactericidal potency against biofilm-grown methicillin-resistant Staphylococcus aureus (MRSA), and methicillin-sensitive Staph. aureus (MSSA) strains. Moreover, tea has inhibitory efficacy against the carcinogenic bacteria.
51 Detection and identification of a new isolate of Grapevine fanleaf Virus naturally infecting Grapevine plants in Egypt using qReal Time-PCR , Dalia Gamil Aseel; Mahmoud Hamdy Abd El-Aziz; E. E. Hafez
Grapevine fanleaf virus (GFLV) is a member of the genus Nepovirus in the family Comoviridae, a widely distributed virus responsible for grapevine (Vitis vinifera) degeneration. This virus causes serious economic losses by reducing grape crop yield. The Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qReal Time-PCR) assay was carried out on (GFLV) recovered from infected grapevines leaves at Alexandria, Egypt. A 606 bp fragment of the GFLV RNA-2 coat protein (CP) gene was amplified and then sequenced. Results of reactions of diagnostic hosts were observed on Gomphrena globosa, which developed systemic mottling, leaves twisting and necrotic spots during spring, whereas Chenopodium amaranticolor induced systemic mottling and leaf deformation, and its sap seemed relatively insensitive to the inhibitors of infection. Mottling of Glycine max was detected after inoculation, but inoculation of Nicotiana glutinosa didn't induce any symptoms. This study aimed to detect and identify a new isolate of GFLV-DA3 from Egypt using biological and molecular tools.
52 Antibacterial potential of the Albizia mahalao Capuron extracts, a Fabaceae from Madagascar , Andriantsihoarana J. Razanatseheno; Lovarintsoa J. Randriamampianina; Hanitra R. Randrianarivo; Danielle A. D. Rakoto; Victor L. Jeannoda
The aim of this study was to assess the antibacterial potential of Albizia mahalao, a Madagascar Fabaceae. Leaf methanolic extracts (LME), root bark methanolic extract (RME), stem bark methanolic extract (SME), and alkaloids extracted from leaves under basic and acidic conditions were used. All the methanol extracts contained alkaloids and saponins. The antimicrobial activity was tested against many bacteria spp. including; Listeria monocytogenes, Staphylococcus aureus, Clostridium perfringens, Enterobacter aerogenes, Salmonella enterica, Shigella flexneri, and Vibrio fischeri, using the Disc diffusion and the Microdilution assays. With the exception of the SME which is inactive, the other extracts exhibited broad spectrum potential against all the tested bacteria. The alkaloids are efficient against nearly all the bacteria under both of the basic and acidic conditions, with an inhibition zone diameter (IZ) of >17 mm, and minimum inhibitory concentration (MIC) of <100 μg/ ml. RME is the least efficient (IZ ≤ 10 mm, and 100< MIC < 1000 μg/ ml). S. enterica is the most sensitive bacterium (IZ= 23 mm, and MIC= 47 μg/ ml), whereas, Staph. aureus (IZ= 10 mm, and MIC >12000 μg/ ml) is the more resistant species. The majority of the extracts expressed bactericidal potency against the tested bacterial spp. Current results revealed the antibacterial potential of the Albizia mahalao leaves and root bark extracts thus could be used to treat infectious diseases.
53 Enhanced anti-oxidant activity of neoagarooligosaccharides produced by β-agarase derived from Aquimarina agarilytica NI125 , Mohamed G. Farahat
The neoagarooligosaccharides have received growing attention owing to their physiological activities. The aim of this study was the isolation of agarase-producing bacteria for production of agar hydrolysates with special emphasis on their anti-oxidant potential. An agarolytic strain NI125 was isolated from Nelson's Island, Alexandria, Egypt. Based on 16S rRNA analysis and extensive phenotypic characterization, it was identified as Aquimarina agarilytica. Maximum enzyme production was achieved after 24 h incubation at 20°C, and tryptone was recorded to be the best nitrogen source for agarase production. Extracellular agarase was partially purified by ammonium sulfate precipitation. The substrate specificity assay using p-nitrophenyl-α/β-D-galactopyranoside revealed the cleavage of the β-linkage rather than the α-linkage. Neoagarooligosaccharides produced by the partially purified β-agarase expressed promising anti-oxidant properties, with 23% free radical scavenging potential. Notable enhancement of the anti-oxidant potency of the oligosaccharides was achieved (up to 87% scavenging ability) by sulfation of the agar prior to hydrolysis for 12 h with β-agarase. Results obtained suggest the potential application of the produced neoagarooligosaccharides anti-oxidants as promising additives in food and feed products.
54 Prevalence and multidrug resistance profiles of several bacterial pathogens isolated from hospital inanimate surfaces in Faisalabad, Pakistan , Hafsa Zaib; Rabia Kanwar; Nishat Zafar; Sultan Ali
Hospital environment and inanimate surfaces are considered as potential sources of opportunistic and nosocomial pathogens. Indirect transmission of microbes from the hospital surfaces has a major role in hospital acquired nosocomial infections and their colonization. The present study was designed to investigate the prevalence of major pathogenic bacteria isolated from hospital inanimate surfaces. Random swab samples were taken from inanimate surfaces and apparatus used in daily treatment of patients from the major hospitals in district of Faisalabad, Pakistan. These swab samples were cultivated on suitable culture media including; nutrient agar, MacConkey’s agar and blood agar to isolate the bacterial pathogens. Identification of the bacterial cultures was carried out by observing the cultural and macroscopic characteristics including Gram staining. Further verification of these bacterial cultures was carried out using appropriate biochemical assays. The biochemical assays were performed for characterization of Staphylococcus aureus, Staph. epidermidis, Staph. saprophyticus, Pseudomonas aeruginosa, Klebsiella pneumonia and Escherichia coli. These pure cultures were then tested for resistance to different antibiotics using the Kirby–Bauer method. The prevalence of Gram positive bacteria (60.83%) was more than that of Gram negative bacteria (24.13%). The results of antibiotics susceptibility tests were analyzed statistically.
55 Resistance prevalence profile of Klebsiella pneumoniae in the Intensive Care Units of Al- Shatby Pediatric Hospital, Alexandria, Egypt , Bassma H. Elwakil; Safaa M. Ali; Soad F. Hafez; Adnan A. Bekhit; Moustafa Y. El-Naggar; Zakia A. Olama
Klebsiella pneumoniae has been identified as an opportunistic pathogen associated with both communityacquired and nosocomial infections mainly among patients admitted to the Intensive care units (ICUs). Some resistant genes were transferred vertically or horizontally within many microbial communities, directly between bacteria through plasmids or integrin. Different techniques including; phenotypic and genetic ones were used to evaluate the presence of β-lactamases among the isolated strains of K. pneumoniae. This bacterial species is the most commonly isolated pathogen (95 isolates) from all the examined samples (51.35%). Current results revealed that 30 and 14 strains of K. pneumoniae are positive to Extended spectrum β-lactamase (ESBL) production, and AmpC β-lactamase producers, respectively. On the other hand, modified carbapenem inactivation and modified Hodge test (MHT) were used to assess the carbapenem resistant strains. It is observed that all the β-lactamase producers’ strains are also carbapenemase producers, whereas only nine strains (30%) are MHT positive. The Polymerase Chain Reaction (PCR) technique revealed that TEM, BETA, NDM and IPM genes are found on the bacterial plasmid (100%). However the presence of the β-lactamase genes on the bacterial DNA varied among the different strains. The presence of the resistance genes on the bacterial plasmid may signify the resistance acquired upon the previous exposure of this bacterium to the different antibiotics. The aims of the current work were to isolate K. pneumonia from Al-Shatby hospital ICUs, to determine the incidence of its β-lactamases, and to decide the frequency of acquisition of 12 different genes among ESBL K. pneumoniae isolates.
56 Green synthesis, Optimization and Characterization of SiO2 nanoparticles using Aspergillus tubingensis F20 isolated from drinking water , Sohila A. Abd Elmohsen; Samah A. Mohmed; Ghadir E. Daigham; Essam M. Hoballah; Nagwa M. Sidkey
This study aimed to demonstrates a positive correlation between silica metal tolerance ability of a drinking water fungi and its potential for the synthesis of silica oxide (SiO2) nanoparticles (NPs). Metal oxide NPs can be synthesized biologically by different methods including; microorganisms, plant extracts and\ or plant biomass. These methods in some time are better alternatives to the chemical and physical methods through an environmentally route. In the present work, twenty fungal strains were isolated from eight potable water samples and tested for producing silica nanoparticles (SiO2NPs), using precursor salt Dipotassium fluorosilicate (K2SiF6). Out of these twenty fungal strains, only one fungal isolate had the potency to reduce metal salt into metal NPs, which was identified by a molecular assay as Aspergillus tubingensis F20, and was assigned an Accession number of (MK226258.1) using the NCBI GenBank database. The factors affecting mono-dispersed production of SiO2 NPs such as; reaction times, incubation temperatures, hydrogen ion concentrations (pH) and salt concentrations were optimized. It is revealed that 10-3 M precursor salt concentration, 72 h of reaction time at pH 3, and an incubation temperature 28°C are the optimum conditions for the production of smaller size NPs. The biosynthesized NPs was characterized using several techniques including; Dynamic light scattering (DLS), Transmission Electron Microscopy (TEM), Scanning Electron Microscopy (SEM), and Energy dispersive X-ray spectroscopy (EDX). It is observed that the shape of SiO2NPs is spherical with an average size of 8 nm, and surface charge of - 8.19 mv, which indicates that SiO2NPs is more stable.
57 Biosynthesis of Copper nanoparticles using bacterial supernatant optimized with certain agro-industrial byproducts , Abd-Elhalim, B.T.; Gamal, R.F.; Abou-Taleb, Kh.A.; Haroun, A.A.
Biosynthesis of green nanomaterials using microorganisms is considered clean, eco-friendly and viable, instead of the physical or chemical methods. This study aimed in the biosynthesis of copper nanoparticles (CuNPs) exploiting Egyptian local bacterial isolates. Sixteen copper-resistant isolates out of 160 bacterial isolates; were captured from various plant rhizospheres including; chamomile, hibiscus, neem, iris, and pea, beside samples collected from the Sharm El-Sheikh seawater. Among the 16 copper-resistant isolates, one promising isolate I108 was chosen which synthesized CuNPs of diameter about 87.1 nm, showed UV absorbance of 0.54 at 580 nm, with a concentration of 12.21 mg\ l. This isolate was characterized by phenotypic and genotypic features. Based on 16S rRNA gene analysis and compared with the sequences presented in NCBI GenBank, the phylogeny positions assessment confirmed that it belonged to Genus Pseudomonas, and was closely related to Pseudomonas silesiensis strain A3 (98% similarity). For the bacterial synthesis of CuNPs, optimization of the P. silesinsis strain A3 cell-free supernatant was carried out using seven agro-industrial residues, added to the basal medium as different carbon sources. Results showed that 2% blackstrap sugar cane molasses was the most efficient carbon source for CuNPs biosynthesis, when incubated for at 30°C for 24 h using shaking speed of 120 rpm. The biosynthesized CuNPs has a size of 66.12 nm at a concentration of 19.2 mg\ l, and maximum surface plasmon peak (SPR) of 0.85.
58 Anti-dermatophytic activity and FTIR analysis of Petroleum ether extracts of Azadirachta indica A. Juss seed (Meliaceae) , Ungo-kore, H.Y; Ibrahim, Y.K.E.; Tytler, B.A.
Plant derived medicines have made massive contributions to the humans over the years. Azadirachta indica is used in ethnomedicine to treat ailments such as; eczema, ringworm, sore throat, respiratory tract infection, and scabies. Seeds of A. indica were collected, shade dried, pulverized and extracted with petroleum ether using soxhlet and cold maceration. Physicochemical analysis of the seed oil was carried out as described by the Association of Official Analytical Chemists methods. The oil was fractionated using column chromatography, and then Infra-Red (IR) analysis was carried out using a spectrophotometer. The antifungal activities of the oil and Terbinafine standard compound were evaluated by determining the minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC), using the Agar diffusion method. The petroleum ether oil recovered from the soxhlet method of extraction showed higher percentage of yield, whereas the oil obtained from cold maceration exhibited higher diameter of inhibition zones against several dermatophytes including; Trichophyton mentagrophytes, T. rubrum and Microsporum canis, ranging from 12.00- 16.33 mm. The MIC and MFC values of the oil ranged from 6.25 to > 50% v/v, and 12.5 to > 50% v/v, respectively. Moreover, the seed oil and its fractions recorded classes of several compounds which included; alkyl, alkanes, alkenes, aliphatic esters, ketone, carboxylic acid, amide, and alkyl halide. The seed oil had inhibitory potential against a dermatophyte which causes ring worm (T. corporis), thus confirmed the claims of using the A. indica extract for treatment of such disease. This study aimed to evaluate the antidermatophytic activities of the oil obtained from A. indica seeds using petroleum ether, and their fractions.
59 New source of cellulase production using a metagenomic technique , Safaa M. Ali; Nadia A. Soliman
The cellulase enzymes with high effectiveness under conditions agreeable to the industrial processes necessities are one of the keys for the successful development of chemical and drug synthesis. The soil metagenome is an affluent source for the discovery of new natural products. The objective of the current study was to identify the isolated functional gene(s) of the cellulase enzyme by using metagenomics. The plan of work composed of collection of different soil samples, isolation of total DNA, fragmentation, cloning, and expression of the isolated gene(s) in the suitable host microorganism. The total genomic DNA was extracted using a kit (QIAGEN), and then digested by different restriction enzymes BamHI. The digested fragments ranging from ~300-5000 bp were ligated, cloned into pUC19 vector, and then transformed into Escherichia coli DH5α. The resulting clones were screened as cellulase producers using a qualitative method. The positive clones which showed hydrolysis on the plate were screened once more in Luria-Bertani (LB) medium. The plasmids were isolated and then tested using universal primer (M13), to detect the fragment size and sequence for the Polymerase Chain Reaction (PCR) products. This study establishes an effortless and professional method for cloning of recent cellulase genes through ecological metagenomes. In the outlook, the metagenomic guide approachs may be functional to the elevated selection of novel cellulase from the environment.
60 Role of the JC Polyomavirus (JCV) and BK Polyomavirus (BKV) in the colorectal cancer of some Egyptian patients , Sherihan Samir; Ahmed B. Barakat; Waled M. El-Senousy; Ahmed A. Abou-Zeid; Omar A. Rabiee
Although several cases and case-control studies reported the prevalence of JC polyomavirus (JCV) and BK polyomavirus (BKV) in tumor tissues of colorectal cancer (CRC) patients as well as in control samples; however, many recent studies did not show the prevalence of these viruses in the CRC patients. A total of 50 clinical biopsies samples were collected from patients with and without CRC in the General surgery department, Faculty of Medicine, Ain Shams University, Egypt, with the approval of the research ethics committee. Current results showed the absence of the genomic DNA of both JCV and BKV in the tumor tissue samples, adjacent-tumor normal mucosa samples from CRC patients, and also in the normal mucosa samples collected from the non-CRC patients. Moreover, results of the semi-nested PCR and real-time PCR are similar, and confirmed that JCV and BKV are not prevalent in the Egyptian CRC patients. There are no promising results for further investigation of the expression of the large T-Ag protein, and any other related proteins in the tumor cells. Based on the present results, no evidence supports the association between the JCV, BKV and CRC in the Egyptian patients. For the best of our knowledge, this is the first case-control study on the prevalence of JCV and BKV in the Egyptian CRC patients. The aim of the current study was to detect the presence of JCV and BKV genomic DNA in the tissue samples, to support further studies on the role of these viruses in the CRC etiology and development.
61 First report of the association of Genus Chaetomium with roots of Cucurbita maxima , Jonathan D. Hulse
Chaetomium sp. is a fungal genus in the Ascomycota that has a world-wide distribution throughout tropic and temperate regions. Species of Chaetomium are often associated with and classified as both seed-borne and soilborne fungi, which inhabit a variety of terrestrial ecosystems including; agricultural, forests, grasslands, wetlands, and coastal zones. Chaetomium sp. plays an important ecological role as a saprophyte, but also shows strong antimicrobial activities which allow its use as a biological control agent (BCA). Chaetomium sp. has been recorded on the seeds and within the rhizosphere of a variety of genera of the family Cucurbitaceae including; Citrullus, Cucumis, Cucurbita, Lagenaria, and Luffa. Within the genus Cucurbita, Chaetomium sp. has been documented in association with Cucurbita pepo and Cucurbita moschata, however up till now there is no record of association of Chaetomium sp. with Cucurbita maxima. Sampling of Cucurbita maxima roots in the eastern United States resulted in the discovery of a novel relationship between Cucurbita maxima and Chaetomium sp. This manuscript presents the first report of existence of a relationship between Chaetomium sp. and Cucurbita maxima, with the aid of light microscope to image the perithecia and spores produced by this fungus.
62 Interleukin-27 levels and its Polymorphism in Hepatocellular carcinoma associated with Hepatitis C , Nahla Anber; Maysaa El Sayed Zaki; Mona El Wassefy
The prevalence of Hepatocellular carcinoma (HCC) in Egypt represents about 11% of the gastrointestinal tract malignancies. The development of HCC usually is preceded by chronic infections with Hepatitis C virus (HCV). Interleukin-27 (IL27) is implicated in the antiviral immunity. Little is known about the use of IL27 as a biomarker for the development of HCC associated with HCV. Moreover, the role of IL-27 rs153109 gene polymorphism in the development of HCC associated with HCV has not been well studied yet. A case control study included three groups; Group I, 60 healthy control patients, Group II, 60 patients with cirrhosis associated with HCV infection, and Group III, included 60 patients with HCC associated with HCV. ELISA technique was used to measure serum IL27, while restriction fragment length polymorphism (RFLP) was used to detect singlenucleotide polymorphisms (SNP). Results showed that the serum levels of IL27 is significantly higher in both cirrhotic and HCC groups. G allele is significantly associated with HCC and cirrhotic cases, compared with the healthy control group. Current results encourage the use of IL 27 as a diagnostic marker for both cirrhotic and HCC diseases. The aims of current work were to study the serum levels of IL27 in HCV positive hepatic patients, to evaluate its role as a biomarker for early detection of HCC, and to find any association of rs153109 with the hepatic diseases.
63 Electro-fermentative production of thermotolerant lipases by electrogenic bacteria isolated from palm oil mill effluents , E.O. Garuba; O.M. Ajunwa; O.S. Oguntomi; A.A. Onilude
This study aimed at assessing the effects of Bio-electrochemical system on the yield of thermostable lipase produced by Bacillus licheniformis S1S2, Bacillus pulmilus S1E23, Bacillus sp. S1E27, and Aeribacillus sp. S1E29. With physiological conditioning of the lipolytic activities, comparative production of thermostable lipase by the selected isolates was carried using submerged fermentation and electro-fermentation methods. An optimum lipase yield of 95.1± 0.003 U/ ml, 128± 0.001 U/ml, 110.7± 0.003 U/ ml and 122.7± 0.002 U/ml was produced by B. licheniformis S1S2, B. pulmilus S1E23, Bacillus sp. S1E27, and Aeribacillus sp. S1E29; respectively, under conventional fermentation process. However, under electro-fermentation, increased enzyme yields of 129.6± 0.002 U/ml, 164.9± 0.001 U/ml, 125.3± 0.002 U/ml, and 136.6± 0.001 U/ml, for same respective isolates was obtained. The biophysical characteristics of the enzymes produced showed that the thermostable lipases had optimum activity at a temperature range of 45oC - 55oC, pH of 7 - 9, and enhanced activity in the presence of Ca2+, Mg2+, and Zn2+, however, Hg2+ caused a slight loss in the lipase activity.
64 Optimization of cellulase and chitinase enzymes production by plant growth promoting rhizobacteria , Alaa Fathalla Mohammed
The current study aimed to optimize the production of cellulase and chitinase enzymes by plant growth promoting rhizobacteria (PGPR). Bacteria were pre-isolated from soil and identified as; Pseudomonas fluorescens NBRC (KW1), Serratia liquefaciens ATCC 27592 (EW1), Bacillus subtilis SBMP4 (EF1) and Bacillus megaterium NBRC 15308 (TF2). The effect of different growth parameters including; pH, temperature, carbon and nitrogen sources, and incubation periods were optimized for production of cellulase and chitinase enzymes by the selected bacterial strains. Three strains mainly, B. subtilis SBMP4, S. liquefaciens ATCC 27592 and P. fluorescens NBRC) recorded positive results for cellulase production. B. subtilis SBMP4 (EF1) and S. liquefaciens ATCC 27592 (EW1) strains demonstrated significant ability to produce cellulase at 40°C, while P. fluorescens NBRC (KW1) strain showed the maximum enzyme production at 30°C. Carboxymethyl cellulose gave the highest cellulase production compared to the other carbon sources. Chitinase enzyme was optimally produced by B. subtilis SBMP4 and S. liquefaciens ATCC 27592 strains under primary screening. B. subtilis SBMP4 had the strongest ability to produce chitinase at 40oC, while S. liquefaciens ATCC 27592 at 30oC. The optimum pH observed was at pH 6.0 to get the maximum chitinase production by S. liquefaciens ATCC 27592. Potassium nitrate (KNO3) as an inorganic nitrogen source presented the highest chitinase production by B. subtilis SBMP4, whereas yeast extract demonstrated significant chitinase production by S. liquefaciens ATCC 27592.
65 Aflatoxins and aflatoxigenic fungal contamination of common poultry feed products in Katsina State, Nigeria , Bahauddeen Dandashire Salisu; Ibrahim Raubilu Almajir
This study was conducted to screen the common poultry feed products sold within Katsina State, Nigeria, for the presence of aflatoxigenic fungi and aflatoxins. A total of 15 poultry feed samples from 3 major producing companies were purchased from retailers, and then cultured for fungal isolation on potato dextrose agar (PDA) supplemented with Cycloheximide. Fungal colonies were identified using standard mycological techniques. The samples were further extracted using a methanol-water solvent (v/v) 1:2, and the extracts were analyzed for the presence of aflatoxins using Fourier Transform Infrared Spectroscopy (FTIR). A total of 30 fungal isolates comprising Aspergillus spp. (30%), Mucor spp. (30%), Rhodotorula spp. (13.3%), Rhizopus spp. (10%), Saccharomyces spp. (10%), Geotrichum spp. (3.3%) and Endomyces spp. (3.3%) were recovered. The FTIR results showed that 10% of the samples were contaminated by aflatoxins as evidenced by the presence of peaks/wavenumbers specific for aflatoxins’ functional groups in their FTIR spectra (2850 to 3100 cm-1 , 1650 to 2000 cm-1 , 1670 to 1820 cm-1 , 1400 to 1600 cm-1 , 1364 to 1369 cm-1 and 1040 to 1050 cm-1 , for aromatic –C–H and CH2, in-plane aromatic –CH bending, Carbonyl C=O, aromatic C=C, –CH3 adjacent to epoxy ring, and symmetric stretching of =C–O–C, respectively). The poultry feeds analyzed were contaminated by aflatoxigenic fungi and aflatoxins, in addition to other potentially pathogenic fungi. Therefore, more stringent prevention and control methods are required to reduce the contamination levels, to avoid loss of poultry lives and possible transfer of carcinogenic mycotoxins to humans along the food chain.
66 Isolation and full genome sequencing of two human Astroviruses isolated from children in Cairo, Egypt , Ahmed El Taweel; Ahmed Kandeil; Ahmed Barakat; Omar El Faroq; Ghazi Kayali; Mohamed Ahmed Ali
Astroviridae is a diverse family of viruses that are circulating in a wide range of hosts. Diversity of these viruses plays a major role in the emergence of zoonotic diseases. Limited studies were conducted on the prevalence and genetic proprieties of human Astroviruses in Egypt. Despite the molecular and serological evidences of the existence human astroviruses in several regions of Egypt, attempts to isolate these viruses have been largely unsuccessful. The aims of the current study were to isolate and make full genome sequencing of two human Astroviruses genotype 1 and 4, from infected children in Cairo, Egypt. Currently, we report the isolation and full-genome sequencing of two human isolates based on our novel designed overlapped primers. The original stool samples were collected from children suffering from diarrhea, residing in Abo-El-Reesh Hospital, Cairo, Egypt, and were well characterized as having astrovirus infections. The phylogenetic relationship of the obtained sequences of our isolates collected in 2016, revealed that they are related to human astrovirus genotype 1 (HAstV1) and human astrovirus genotype 4 (HAstV4) isolates recovered from Italy and Russia; respectively, during this decade. The genetic diversity of the other HAstVs circulating in Egypt needs to be fully identified, as a first step toward the control strategy of this neglected virus.